Philosopher guy. Founded the CCRU (Cybernetic Culture Research Unit) with Sadie Plant, which has been accused of being a cult (they did a lot of drugs). Founder of accelerationism. Drove himself insane in the recent years in an attempt to reach the Outside. Now he's the figurehead of a white supremacy movement and runs a boomer twitter.
He likes creating neologisms which people have criticized him for, as well as a lucid and generally difficult to understand-at-times writing style, coming off as jargon jargon jargon. Personally I think it's beautiful, although it feels a bit like staring directly at Cthulhu sometimes.
“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
― Nick Land, Fanged Noumena: Collected Writings 1987 - 2007
“Level-1 or world space is an anthropomorphically scaled, predominantly vision-configured, massively multi-slotted reality system that is obsolescing very rapidly.
Garbage time is running out.
Can what is playing you make it to level-2?”
― Nick Land
“Whenever its name has been anything but a jest, philosophy has been haunted by a subterranean question: What if knowledge were a means to deepen unknowing?”
― Nick Land, Fanged Ndirectoumena: Collected Writings, 1987-2007
I'm thinking ILE-Ti