Results 1 to 7 of 7

Thread: Nick Land

  1. #1
    удобный сукин сын Cybel's Avatar
    Join Date
    Aug 2017
    Location
    rat
    TIM
    SLI2Te
    Posts
    386
    Mentioned
    38 Post(s)
    Tagged
    0 Thread(s)

    Default Nick Land

    Philosopher guy. Founded the CCRU (Cybernetic Culture Research Unit) with Sadie Plant, which has been accused of being a cult (they did a lot of drugs). Founder of accelerationism. Drove himself insane in the recent years in an attempt to reach the Outside. Now he's the figurehead of a white supremacy movement and runs a boomer twitter.



    He likes creating neologisms which people have criticized him for, as well as a lucid and generally difficult to understand-at-times writing style, coming off as jargon jargon jargon. Personally I think it's beautiful, although it feels a bit like staring directly at Cthulhu sometimes.

    “Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
    Nick Land, Fanged Noumena: Collected Writings 1987 - 2007

    “Level-1 or world space is an anthropomorphically scaled, predominantly vision-configured, massively multi-slotted reality system that is obsolescing very rapidly.

    Garbage time is running out.

    Can what is playing you make it to level-2?”
    Nick Land

    “Whenever its name has been anything but a jest, philosophy has been haunted by a subterranean question: What if knowledge were a means to deepen unknowing?”
    Nick Land, Fanged Ndirectoumena: Collected Writings, 1987-2007

    I'm thinking ILE-Ti
    Attached Images Attached Images
    Last edited by Cybel; 09-06-2020 at 12:48 AM.

     



  2. #2
    Adam Strange's Avatar
    Join Date
    Apr 2015
    Location
    Midwest, USA
    TIM
    ENTJ-1Te 8w7 sx/so
    Posts
    9,543
    Mentioned
    1026 Post(s)
    Tagged
    2 Thread(s)

    Default

    He looks like an intrusive creep and he has logorrhea. I agree with the Ne-ness of him, but I have a hard time seeing an ILE being that involved with life forms of any sort. I think he just talks all the time and says nothing, because some people just want U to See See them. I'd call him IEE, and a very disturbed one at that.

  3. #3
    удобный сукин сын Cybel's Avatar
    Join Date
    Aug 2017
    Location
    rat
    TIM
    SLI2Te
    Posts
    386
    Mentioned
    38 Post(s)
    Tagged
    0 Thread(s)

    Default

    Well his current state shouldn't discount his pre-Dark Enlightenment works, which are fascinating and I see myself spending years just pouring over it

    "Strange scenes ensued: A seminar on A Thousand Plateaus where a group of nonplussed graduates were encouraged to ‘read’ the chapter titles of the book by turning them into acronyms that were then plotted as vectors on a diagram of a QWERTY keyboard (‘qwertopology’);
    A three-week long experiment in refusing to speak in the first person, instead referring to the collective entity ‘Cur’ (comprising the hardcore participants in ‘Current French Philosophy,’ who extended the lectures into a continual movable seminar);
    and, most memorably, a presentation at the conference
    Virtual Futures in 1996: Rather than reading a paper, in this collaboration with artist collective Orphan Drift, under the name of ‘DogHead SurGeri,’2 and complete with jungle soundtrack, Land lay behind the stage, flat on the floor (a ‘snake-becoming’ forming the first stage of bodily destratification), croaking enigmatic invocations intercut with sections from Artaud’s asylum poems. In this delirious vocal telegraphy, meaning seemed to disintegrate into sheer phonetic matter, melting into the cut-up beats and acting directly on the subconscious. As Land began to speak in his strange, choked-off voice (perhaps that ‘absurdly high pitched ... tone ... ancient demonists described as ‘silvery,’ which he later reports being taunted by),3 the disconcerted audience begin to giggle; the demon voice wavered slightly until Land’s sense of mission overcame his momentary self-consciousness; and as the ‘performance’ continued the audience fell silent, eyeing each other uncertainly as if they had walked into a funeral by mistake."

    lmao
    Last edited by Cybel; 09-06-2020 at 12:53 AM.

     



  4. #4
    shotgunfingers's Avatar
    Join Date
    May 2020
    Location
    Romania
    TIM
    LSI-H™
    Posts
    1,575
    Mentioned
    127 Post(s)
    Tagged
    0 Thread(s)

    Default

    looks like things took their toll on him.
    He reminds me of how COVID (an ILE here) writes lol.

  5. #5
    удобный сукин сын Cybel's Avatar
    Join Date
    Aug 2017
    Location
    rat
    TIM
    SLI2Te
    Posts
    386
    Mentioned
    38 Post(s)
    Tagged
    0 Thread(s)

    Default

    Quote Originally Posted by shotgunfingers View Post
    looks like things took their toll on him.
    He reminds me of how COVID (an ILE here) writes lol.
    nahh this guy makes COVID look like an uptight basic starbucks bitch

     



  6. #6
    shotgunfingers's Avatar
    Join Date
    May 2020
    Location
    Romania
    TIM
    LSI-H™
    Posts
    1,575
    Mentioned
    127 Post(s)
    Tagged
    0 Thread(s)

    Default

    Quote Originally Posted by snek View Post
    nahh this guy makes COVID look like an uptight basic starbucks bitch
    True. e_e fuck why do I know all this weird shit? Goddamn Ti-Ni loops..


  7. #7
    The Banana King's Avatar
    Join Date
    Jan 2021
    TIM
    ILE-Ti-H FLEV
    Posts
    8
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Default

    There's a lot of gesticulation when explaining, and gestures occur first, then words follow (N dom/perceiver). His whole head and body seems to move around while explaining, that's more Ne > Ni imo. He reminds me a lot of the way I gesture when explaining something, hands moving all over the place lol.
    His gaze however seems really defocused (or he's fixated at a camera rather than a human interlocutor). That gives me really Ni vibes. I always engage people in the eye when talking. Ni-egos and even Ni HA types seem to have that drifty, 'seeing-through-you' look in their eyes when they talk.
    His verborrhea makes me think Ni > Ti. The stronger the Ti the more crisp and to the point imo. Just recalling from the different SLE-Ti and ILE-Ti I have met. None of them were too verbose or 'difficult to understand'.
    He seems to use a lot of 'coined' concepts in his talk/writing. That's hallmark Ti behavior, manipulating words and just making your own structures to explain stuff, rather than using preexisting terms and structures:
    >anthropomorphically scaled, predominantly vision-configured, massively multi-slotted reality system
    This kind of (noun + verb) compound adjective is something I like to use sometimes lol. But I don't have a damn clue what he's trying to say. At any rate that's typical Ti + intuition speech quirk.
    So he could be an ILE-Ti after all. Or a messed up IEI-Ni or LII-Ne even.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •